Stem-loop sequence aly-MIR848

AccessionMI0014645 (change log)
DescriptionArabidopsis lyrata miR848 stem-loop
Gene family MIPF0001140; MIR848
Stem-loop
   uaguuucgacuuccacagccuuuauauagcuuggcaa            u        gaa       cca 
5'                                      ucccaugucaaa aaggcaaa   gaggaac   a
                                        |||||||||||| ||||||||   |||||||   g
3'                                      aggguacaguuu uuccguuu   cucuuug   g
   -------------------------aaucagacaauc            c        --a       uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 5606276-5606393 [-]
intergenic
Database links

Mature sequence aly-miR848-5p

Accession MIMAT0017689
Previous IDsaly-miR848*
Sequence

33 - 

ggcaaucccaugucaaa

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR848-3p

Accession MIMAT0017690
Previous IDsaly-miR848
Sequence

97 - 

ugacaugggacuaacagacuaa

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).