Stem-loop sequence aly-MIR851

AccessionMI0014646 (change log)
DescriptionArabidopsis lyrata miR851 stem-loop
Gene family MIPF0001168; MIR851
Stem-loop
        c   g            g           a     u 
5' aggga ugu gucuuuguuugc acccauacgua ucuuu g
   ||||| ||| |||||||||||| ||||||||||| |||||  
3' ucccu aca cagaaacaaacg ugggugugcau agaga u
        a   g            g           c     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 16404386-16404469 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR851
aly-MIR851GL348717.1: 16404386-16404469 [-]
aly-MIR771GL348717.1: 16404124-16404228 [-]
Database links

Mature sequence aly-miR851-5p

Accession MIMAT0017691
Previous IDsaly-miR851*
Sequence

9 - 

uggucuuuguuugcgacccauacg

 - 32

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR851-3p

Accession MIMAT0017692
Previous IDsaly-miR851
Sequence

55 - 

uguggguggcaaacaaagacgaca

 - 78

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2