Stem-loop sequence aly-MIR3434

AccessionMI0014649 (change log)
DescriptionArabidopsis lyrata miR3434 stem-loop
Gene family MIPF0001174; MIR3434
Stem-loop
      g      c                                                    g    c  c                          -  uuaagucagaucauuggucucucucucaaguaacuuaggguuugaaaaacagcuucuccag 
5' gcg auaaca cuuaaggaaggauuguuuuuguuuuauagguuaacuguggugguaaauuuua cacu gg ugauucucugauuuugaacagggcuu cc                                                             u
   ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||| ||                                                              
3' cgu uguugu gaauuccuuccuaacaaaaacaaaauauccaauugacaccaccauuuaaaau guga cc acuaagagacuaaaacuuguuccgaa gg                                                             c
      -      u                                                    a    a  a                          a  cuucguugcugagcaaagauaaacaccuaaacgacucacaacuccucgucccauucuacga 
Get sequence
Deep sequencing
14 reads, 300 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 9536201-9536524 [-]
intergenic
Database links

Mature sequence aly-miR3434-5p

Accession MIMAT0017697
Previous IDsaly-miR3434*
Sequence

71 - 

gcugauucucugauuuugaac

 - 91

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR3434-3p

Accession MIMAT0017698
Previous IDsaly-miR3434
Sequence

237 - 

ucaaaaucagagaaucaacca

 - 257

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).