![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sja-mir-310 |
|||||
Accession | MI0015298 (change log) | ||||
Description | Schistosoma japonicum miR-310 stem-loop | ||||
Literature search |
1 open access papers mention sja-mir-310 | ||||
Stem-loop |
guagaga ggga --a gaugacgcgacucucguggagaguacuuauccgaagaugacuucau 5' auu gauau gucaa c ||| ||||| ||||| g 3' uaa uugua uaguu a ----cag -aag agg uccggcccuuaaacguuauaaguggcugguauuuggugacugcaaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sja-miR-310 |
|
Accession | MIMAT0016271 |
Sequence |
101 - auauugcaaauucccggccuuu - 122 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|