Stem-loop sequence sja-mir-3492

AccessionMI0015316 (change log)
DescriptionSchistosoma japonicum miR-3492 stem-loop
Gene family MIPF0001622; mir-3492
Literature search

1 open access papers mention sja-mir-3492
(1 sentences)

Stem-loop
   a     c      c   cu   a       u  caccag  c 
5'  gcuuc uguauc gug  gag uuucguc gu      gc a
    ||||| |||||| |||  ||| ||||||| ||      || c
3'  cgaag gcauag cac  cuc agaguag ca      cg c
   g     u      a   --   -       u  ------  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01040935.1: 666-743 [+]
intergenic
CABF01040939.1: 2148-2225 [+]
intergenic
Database links

Mature sequence sja-miR-3492

Accession MIMAT0016301
Sequence

11 - 

auccgugcugagauuucgucu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).