Stem-loop sequence gso-MIR167a

AccessionMI0015357 (change log)
DescriptionGlycine soja miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
   g      u      u    g         ag      uu 
5'  cagcag ugaagc gcca caugaucug  uuuacc  c
    |||||| |||||| |||| |||||||||  ||||||  u
3'  guuguc acuucg cggu guacuagac  gaaugg  a
   a      c      u    -         aa      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR167a

Accession MIMAT0016351
Sequence

9 - 

ugaagcugccagcaugaucug

 - 29

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).