Stem-loop sequence cin-mir-4158

AccessionMI0015713 (change log)
DescriptionCiona intestinalis miR-4158 stem-loop
Stem-loop
   u  cc a  a      -     u   --u   u    --    c    auauguggaguucauu 
5'  gc  g ug uguuau uguuu gca   gua uaac  uuaa gcag                u
    ||  | || |||||| ||||| |||   ||| ||||  |||| ||||                 
3'  cg  c ac acaaua acaaa cgu   cgu guug  aauu uguc                c
   c  au -  -      u     -   uuu   u    ua    u    aauuacgggagucaca 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
12q: 435082-435203 [+]
intergenic
Database links

Mature sequence cin-miR-4158-5p

Accession MIMAT0016764
Sequence

1 - 

ugcccgaugauguuauuguuuu

 - 22

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1