Stem-loop sequence aly-MIR395i

AccessionMI0015778 (change log)
DescriptionArabidopsis lyrata miR395i stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   -----c  aa                    u            - ucc 
5'       uc  gaguuccuccgaacacuuca ugaaaaaagguu c   a
         ||  |||||||||||||||||||| |||||||||||| |   u
3'       ag  cucaaggagguuugugaagu auuuuuuuuuaa g   u
   uauagu  ac                    c            u cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 10978703-10978795 [+]
intergenic
Database links

Mature sequence aly-miR395i

Accession MIMAT0017905
Sequence

63 - 

cugaaguguuuggaggaacuc

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1