Dead miRNA entry

miRNA accession:
MI0015779
miRNA ID:
aly-MIR399j
Forward to:
MI0014637
Comment:
Two MIR399 sequences in miRBase 19 map to one locus in the v1.0 genome assembly. The entries are merged in miRBase 20.

Previous miRNA entry

Stem-loop sequence aly-MIR399j

AccessionMI0015779 (change log)
DescriptionArabidopsis lyrata miR399j stem-loop
Stem-loop
   --aaa    -    u c     a     a       a          ac      uu  c uu     cu 
5'      ggug aaaa g auuac gggca gaucucu uuggcaggaa  cauuac  ga c  ugcau  c
        |||| |||| | ||||| ||||| ||||||| ||||||||||  ||||||  || |  |||||   
3'      ucgc uuuu c uaaug cccgu uuagagg aaccguucuu  gugaug  uu g  acgua  u
   uauaa    g    - u     g     -       a          ga      -u  c uu     uu 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aly-miR399j

Accession MIMAT0017906
Sequence

96 - 

uugccaaaggagauuugcccg

 - 116

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental;

References

1