Stem-loop sequence aly-MIR4224

AccessionMI0015785 (change log)
DescriptionArabidopsis lyrata miR4224 stem-loop
Stem-loop
   -aa         ucg -            a   a     cua        aa      uaucugu    cga 
5'    agguuuuuu   g gacagagaugag aag cucag   uuuguuga  augaaa       gaag   a
      |||||||||   | |||||||||||| ||| |||||   ||||||||  ||||||       ||||    
3'    ucuagagaa   c cugucucuacuc uuc gaguc   aaacaacu  uauuuu       uuuc   a
   gua         uaa a            c   -     aac        --      -----uu    caa 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 24611224-24611359 [+]
intergenic
Database links

Mature sequence aly-miR4224

Accession MIMAT0017912
Sequence

96 - 

caacugagcuuccucaucucu

 - 116

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1