Stem-loop sequence aly-MIR4227

AccessionMI0015788 (change log)
DescriptionArabidopsis lyrata miR4227 stem-loop
Gene family MIPF0001115; MIR4227
Stem-loop
   --guucacac    a           u           u    a        a  -   gu 
5'           gaca cacaauuucau ugugccaauca ucua caaaguau cc ucg  c
             |||| ||||||||||| ||||||||||| |||| |||||||| || |||  u
3'           uugu guguuaaagua acaugguuagu aggu guuucaua gg agu  c
   augacggcua    a           c           u    c        c  u   ga 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 2959485-2959606 [-]
intergenic
Database links

Mature sequence aly-miR4227

Accession MIMAT0017915
Sequence

21 - 

ucauuugugccaaucauucua

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1