Stem-loop sequence aly-MIR4229

AccessionMI0015790 (change log)
DescriptionArabidopsis lyrata miR4229 stem-loop
Stem-loop
   ---ac          c   a             g   c                   aggacguuuugcacgu 
5'      auaaaucguc uaa accuuggcaggga guc uccacacacaauauuuaca                u
        |||||||||| ||| ||||||||||||| ||| |||||||||||||||||||                 
3'      uauuuaguag auu uggaacuguuucu cag agguguguguuauaagugu                g
   aauua          -   g             a   -                   aguuaaaguuucuuac 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 6816117-6816259 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR4229
aly-MIR4230GL348715.1: 6818689-6818807 [-]
aly-MIR4229GL348715.1: 6816117-6816259 [-]
Database links

Mature sequence aly-miR4229

Accession MIMAT0017917
Sequence

21 - 

uuggcagggagguccuccacac

 - 42

Get sequence
Evidence experimental; SOLiD [1]

References

1