Stem-loop sequence aly-MIR4237

AccessionMI0015799 (change log)
DescriptionArabidopsis lyrata miR4237 stem-loop
Stem-loop
   --aaagacu   c            --                          aacau    ua 
5'          guu uaugacaucgau  uauauguuuacguuuguuuuuacguu     guaa  a
            ||| ||||||||||||  ||||||||||||||||||||||||||     ||||  u
3'          caa auacuguagcua  auauacaaaugcaaacaaaaaugcaa     cguu  a
   cauuuauau   a            au                          -auau    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 2528975-2529100 [-]
intergenic
Database links

Mature sequence aly-miR4237

Accession MIMAT0017926
Sequence

85 - 

aaacguaaacauauauaaucga

 - 106

Get sequence
Evidence experimental; SOLiD [1]

References

1