Stem-loop sequence aly-MIR4246

AccessionMI0015808 (change log)
DescriptionArabidopsis lyrata miR4246 stem-loop
Stem-loop
   --  a   au  a  a            aau              c  g   uuaa 
5'   uc cuc  ac gc gaaaccaaaucc   uuucauugcuuaaa cu ugu    u
     || |||  || || ||||||||||||   |||||||||||||| || |||    u
3'   gg gag  ug cg cuuugguuuagg   aaaguaacgaauuu ga acg    u
   au  c   gu  g  c            -gu              a  -   uugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 15703857-15703967 [+]
intergenic
Database links

Mature sequence aly-miR4246

Accession MIMAT0017935
Sequence

21 - 

aaauccaauuuucauugcuuaa

 - 42

Get sequence
Evidence experimental; SOLiD [1]

References

1