Stem-loop sequence ssc-mir-296

AccessionMI0015906 (change log)
DescriptionSus scrofa miR-296 stem-loop
Gene family MIPF0000159; mir-296
Literature search

5 open access papers mention ssc-mir-296
(6 sentences)

Stem-loop 
   --  c     c        c  -         g   ugc 
5'   ga ccuuc ggagggcc cc cccaauccu uug   u
     || ||||| |||||||| || ||||||||| |||   g
3'   cu ggaag ccuuucgg gg ggguuggga gac   g
   gu  c     u        a  c         -   uua
Get sequence
Deep sequencing
276 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 66288704-66288780 [-]
intergenic
Database links

Mature sequence ssc-miR-296-5p

Accession MIMAT0017952
Previous IDsssc-miR-296
Sequence

11 -  

gagggccccccccaauccugu

 - 31

Get sequence
Deep sequencing19 reads, 6 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-296-3p

Accession MIMAT0022958
Sequence

46 -  

aggguugggcggaggcuuucc

 - 66

Get sequence
Deep sequencing256 reads, 15 experiments
Evidence experimental; Illumina [2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).