Stem-loop sequence cbr-mir-357-2

AccessionMI0015958 (change log)
DescriptionCaenorhabditis briggsae miR-357-2 stem-loop
Gene family MIPF0000227; mir-357
Stem-loop 
   -----cuaca  aga   ga        c   g    c  c u          --cua    
5'           uc   aga  cagcgaau ccg caau ac g gcauuuucau     cca 
             ||   |||  |||||||| ||| |||| || | ||||||||||     || g
3'           ag   ucu  guugcuua ggc guua ug c cguaaaagua     gga 
   uacgaaauua  --g   aa        a   a    c  a -          aucac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 4 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrV: 1198325-1198437 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-357-2
cbr-mir-358chrV: 1197871-1197983 [+]
cbr-mir-357-2chrV: 1198325-1198437 [+]
Database links

Mature sequence cbr-miR-357

Accession MIMAT0001298
Sequence

67 -  

aaaaugccagucauugacgga

 - 87

Get sequence
Evidence by similarity; MI0000756

References

1
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).