Stem-loop sequence ame-mir-3717

AccessionMI0016142 (change log)
DescriptionApis mellifera miR-3717 stem-loop
Stem-loop
   uug   a  ug  a      -      g   --g  ug g c    g 
5'    gag gg  ag gaaaaa gagagu ucg   gg  g a guuu a
      ||| ||  || |||||| |||||| |||   ||  | | ||||  
3'    uuc cu  uc cuuuuu cucuua agc   cu  c u uaaa u
   --g   g  gu  -      a      -   aca  gu g -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 4741881-4741968 [-]
intergenic
Database links

Mature sequence ame-miR-3717-5p

Accession MIMAT0018512
Sequence

10 - 

ugagagaaaaagagagugucgg

 - 31

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).