Stem-loop sequence ame-mir-3756

AccessionMI0016157 (change log)
DescriptionApis mellifera miR-3756 stem-loop
Stem-loop
   a            --ucau         u                      aaua            u 
5'  agcauacaaaug      cugauuucu ucauaaggaggauuucaaaaau    uugcaauauugu u
    ||||||||||||      ||||||||| ||||||||||||||||||||||    |||||||||||| u
3'  ucguauguuuac      gacuaaaga aguauucuucuuaaaguuuuua    aacguuauaaca u
   c            uauuuc         u                      -aaa            u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 108960-109095 [-]
intergenic
Database links

Mature sequence ame-miR-3756-5p

Accession MIMAT0018527
Sequence

18 - 

cugauuucuuucauaaggagga

 - 39

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).