Stem-loop sequence ame-mir-3757

AccessionMI0016159 (change log)
DescriptionApis mellifera miR-3757 stem-loop
Stem-loop
   --gga    ua     g        a      c   c          - ---uucu     u    a 
5'      uugg  gaugu aaagagaa gaagaa uga uuuaauaugu c       auuau aaaa u
        ||||  ||||| |||||||| |||||| ||| |||||||||| |       ||||| |||| g
3'      aacu  uuaua uuucuuuu cuuuuu auu agguuauaua g       uaaug uuuu c
   auaug    --     a        a      u   a          c ucuaauc     u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL630385.1: 13743-13871 [-]
intergenic
Database links

Mature sequence ame-miR-3757-3p

Accession MIMAT0018529
Sequence

91 - 

uggaauuauuuuuucauuuucuu

 - 113

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).