Stem-loop sequence ame-mir-3760

AccessionMI0016163 (change log)
DescriptionApis mellifera miR-3760 stem-loop
Stem-loop
   aa     a           auuuuc    ucu   -      ----------u        a     a  aaa  a 
5'   auaaa auuuguuuaau      uuau   uaa aucaua           gaauaauc uuucu ga   au g
     ||||| |||||||||||      ||||   ||| ||||||           |||||||| ||||| ||   || a
3'   uauuu uaaauagauua      aaua   auu uaguau           uuuauuag aaaga cu   ua g
   -a     a           ------    uuu   a      uaaacuuacuu        -     a  --g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 1227869-1228002 [+]
intergenic
Database links

Mature sequence ame-miR-3760-5p

Accession MIMAT0018533
Sequence

35 - 

aaucauaugaauaaucauuucuag

 - 58

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).