Stem-loop sequence ame-mir-3761

AccessionMI0016164 (change log)
DescriptionApis mellifera miR-3761 stem-loop
Stem-loop
   -      u       -    --gug     g   g   -a    --c        u      auauuuuuuu 
5'  cugucu uuucauu auug     gucgu ugg ucg  uucc   gggccucg guguuu          u
    |||||| ||||||| ||||     ||||| ||| |||  ||||   |||||||| ||||||          c
3'  gauaga aagguag uagc     cagca gcc ggc  aagg   cucggagc uacgag          a
   a      u       a    agcga     a   g   aa    aac        -      cuuuucucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 12217824-12217962 [+]
intergenic
Database links

Mature sequence ame-miR-3761-5p

Accession MIMAT0018534
Sequence

32 - 

ucgauucccgggccucgugugu

 - 53

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).