Stem-loop sequence ame-mir-3764

AccessionMI0016167 (change log)
DescriptionApis mellifera miR-3764 stem-loop
Stem-loop
   ac   u    uugugacgu      u  uu        u    gc   c      ----g   g 
5'   gug gauu         guuggg uu  ggaagaau cuag  auu guugcu     gug u
     ||| ||||         |||||| ||  |||||||| ||||  ||| ||||||     ||| c
3'   uac cuaa         uaauuc ag  ucuuuuua gauu  uaa caauga     cgc u
   -u   -    uguuaauuu      u  uu        -    --   -      gugga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 12964383-12964503 [-]
intergenic
Database links

Mature sequence ame-miR-3764-3p

Accession MIMAT0018537
Sequence

83 - 

uagauuuuucuuugaucuuaa

 - 103

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).