Stem-loop sequence ame-mir-3771

AccessionMI0016177 (change log)
DescriptionApis mellifera miR-3771 stem-loop
Stem-loop
   -ga       -    a    a     gaac    cu 
5'    ugcucgu uaau ucgc guguu    gugg  a
      ||||||| |||| |||| |||||    ||||   
3'    acgagca guug agcg cacaa    uauu  a
   ugc       c    -    a     --aa    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 18701743-18701811 [+]
intergenic
Database links

Mature sequence ame-miR-3771-3p

Accession MIMAT0018547
Sequence

42 - 

uaaaacacagcgaguugcacgag

 - 64

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).