Stem-loop sequence ame-mir-3780

AccessionMI0016188 (change log)
DescriptionApis mellifera miR-3780 stem-loop
Stem-loop
   aa   cgu    agua    u    c    --ua  -  a   aacuuu   ua  -     u 
5'   cuc   cgag    uaac gcgg aucg    ac ug caa      ccg  gc ugcau u
     |||   ||||    |||| |||| ||||    || || |||      |||  || |||||  
3'   gag   gcuc    auug cgcc uagu    ug ac guu      ggc  cg gcgua a
   -a   auu    ----    u    u    gaaa  c  -   ---gcc   -c  u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 10263172-10263285 [-]
intergenic
Database links

Mature sequence ame-miR-3780-5p

Accession MIMAT0018558
Sequence

18 - 

aacugcggcaucguaacugac

 - 38

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).