Stem-loop sequence ame-mir-3785

AccessionMI0016194 (change log)
DescriptionApis mellifera miR-3785 stem-loop
Stem-loop
   - cg    u   uc     ---     u            c     g    c  cg  -   cuc 
5'  g  uaaa gug  ucgau   ucucc ugggaggucuca gacgu auag gg  cc cga   u
    |  |||| |||  |||||   ||||| |||||||||||| ||||| |||| ||  || |||   c
3'  c  guuu cac  agcug   agggg guccuucagagu cugca uguc cc  gg guu   g
   u cu    -   cc     ucu     c            c     a    -  au  u   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 11271240-11271365 [-]
intergenic
Database links

Mature sequence ame-miR-3785-3p

Accession MIMAT0018564
Sequence

73 - 

uacccuguaacguccugagacu

 - 94

Get sequence
Evidence experimental; SOLID [1], Illumina [2-3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).