Stem-loop sequence ame-mir-3786

AccessionMI0016195 (change log)
DescriptionApis mellifera miR-3786 stem-loop
Stem-loop
   aca  aacaaa   u   c     c         uu         c gaa  u 
5'    gg      acg guc gacgu uuguccugg  cauguaggg g   ug u
      ||      ||| ||| ||||| |||||||||  ||||||||| |   || a
3'    cc      ugc cgg cugca agcaggacu  guaugucuc c   ac c
   --a  --aacc   u   u     u         cg         a -aa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 4694619-4694722 [-]
intergenic
Database links

Mature sequence ame-miR-3786-5p

Accession MIMAT0018565
Sequence

25 - 

cuuguccugguucauguagggcg

 - 47

Get sequence
Evidence experimental; SOLID [1], Illumina [3]

Mature sequence ame-miR-3786-3p

Accession MIMAT0037387
Sequence

65 - 

ucuguauggcucaggacgauac

 - 86

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).