Stem-loop sequence ame-mir-3794

AccessionMI0016208 (change log)
DescriptionApis mellifera miR-3794 stem-loop
Literature search

1 open access papers mention ame-mir-3794
(1 sentences)

Stem-loop
   cga    gag      uaua  -   u        ac      g  ag 
5'    auug   gaucga    ug gaa ggaagagg  guuucc cg  u
      ||||   ||||||    || ||| ||||||||  |||||| ||  a
3'    ugac   cuaguu    ac cuu ucuuuucu  caaagg gc  a
   --g    -ag      uaac  g   -        -a      a  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 7122109-7122201 [+]
intergenic
Database links

Mature sequence ame-miR-3794-5p

Accession MIMAT0018578
Sequence

21 - 

uggaauggaagaggacguuucc

 - 42

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).