Stem-loop sequence ame-mir-3797

AccessionMI0016212 (change log)
DescriptionApis mellifera miR-3797 stem-loop
Stem-loop
   -  gg   ga  u  c  g -a         -aagug  aaac       cgaaacc       ---       g 
5'  cg  aca  ac gg uc u  uuuuauuuc      uc    cuccucu       uccgcuc   cgugaga a
    ||  |||  || || || |  |||||||||      ||    |||||||       |||||||   |||||||  
3'  gc  ugu  ug cc ag a  gaaauaaag      ag    gaggaga       aggcgag   gcgcuuu c
   u  ua   gc  -  a  g ga         aaggaa  -aaa       ------a       ccu       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 3505663-3505800 [+]
intergenic
Database links

Mature sequence ame-miR-3797-5p

Accession MIMAT0018582
Sequence

6 - 

cagaacuggcucguauuuuauu

 - 27

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).