Stem-loop sequence ame-mir-3799

AccessionMI0016215 (change log)
DescriptionApis mellifera miR-3799 stem-loop
Stem-loop
   uc   cuua   uu        auu      c     -   a 
5'   gau    gcg  ggaacgau   gauuga ucgau aga a
     |||    |||  ||||||||   |||||| ||||| ||| a
3'   cua    cgu  cuuugcua   uuagcu agcug ucu c
   -a   --ag   gc        acc      c     g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 1277153-1277235 [-]
intergenic
Database links

Mature sequence ame-miR-3799-5p

Accession MIMAT0018585
Sequence

17 - 

aacgauauugauugacucgau

 - 37

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).