Stem-loop sequence ame-mir-2796

AccessionMI0016221 (change log)
DescriptionApis mellifera miR-2796 stem-loop
Gene family MIPF0001057; mir-2796
Stem-loop
   aa   ------   aaga  ag  a   -         -  u  gg      au      c    agca 
5'   gga      ggg    ga  ga cgu agcgauaag gu ag  guuucu  cggccu cagc    a
     |||      |||    ||  || ||| ||||||||| || ||  ||||||  |||||| ||||     
3'   ccu      ccc    cu  cu gca ucgcuguuc cg uc  caaagg  gccgga guug    c
   -a   agaaag   --gg  -g  a   a         u  u  au      cg      u    guag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 8061023-8061150 [-]
intergenic
Database links

Mature sequence ame-miR-2796-3p

Accession MIMAT0018591
Sequence

71 - 

guaggccggcggaaacuacuugc

 - 93

Get sequence
Evidence experimental; SOLID [1], Illumina [2-3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).