Stem-loop sequence ame-mir-3730

AccessionMI0016228 (change log)
DescriptionApis mellifera miR-3730 stem-loop
Stem-loop
   uaacuucauuauguauc  ---     -   ---         a    u   u  auu 
5'                  gc   gauga aca   acgagggug agau gcg gu   u
                    ||   ||||| |||   ||||||||| |||| ||| ||    
3'                  cg   cuacu ugu   ugcuccuau ucua cgc ua   g
   ----------------u  acc     a   cuu         c    -   u  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 6958614-6958707 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3730
ame-mir-277CM000058.5: 6958025-6958108 [+]
ame-mir-3730CM000058.5: 6958614-6958707 [+]
ame-mir-34CM000058.5: 6962684-6962783 [+]
Database links

Mature sequence ame-miR-3730-5p

Accession MIMAT0018598
Sequence

25 - 

acaacgagggugaagauugcgug

 - 47

Get sequence
Evidence experimental; SOLID [1], Illumina [2-3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).