Stem-loop sequence ame-mir-3736

AccessionMI0016235 (change log)
DescriptionApis mellifera miR-3736 stem-loop
Literature search

1 open access papers mention ame-mir-3736
(1 sentences)

Stem-loop
   cga      cg     gg ga      ---       ---   -   a   au   c 
5'    gaucug  uccuc  c  uuaccc   ugaguau   gcu ccg ugc  agg g
      ||||||  |||||  |  ||||||   |||||||   ||| ||| |||  ||| u
3'    cuggac  ggggg  g  gauggg   guucaug   cgg ggc gcg  ucc g
   --g      uu     -a aa      cug       cuc   u   a   cc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 11979270-11979376 [-]
intergenic
Database links

Mature sequence ame-miR-3736-5p

Accession MIMAT0018605
Sequence

19 - 

cgauuacccugaguaugcucc

 - 39

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).