Stem-loop sequence hvu-MIR171

AccessionMI0016461 (change log)
DescriptionHordeum vulgare miR171 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention hvu-MIR171
(90 sentences)

Stem-loop
   gcggguugauggccaggaacucc      a   g  u  -     c  u     u         u  a    c     -  -a     g   ga 
5'                        gacaag gga ga gc ugaaa gg cacua gauguuggc cg cuca ucaga cc  cgccg agg  g
                          |||||| ||| || || ||||| || ||||| ||||||||| || |||| ||||| ||  ||||| |||   
3'                        cuguuc ccu cu cg acuuu uc gugau cuauaaccg gc gagu agucu gg  gcggc ucu  c
   -----------cacccacuaccg      -   g  -  u     c  -     u         u  c    u     u  cg     g   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR171-5p

Accession MIMAT0022971
Sequence

57 - 

uguuggcucgacucacucaga

 - 77

Get sequence
Evidence experimental; Illumina [4], Northern [5]

Mature sequence hvu-miR171-3p

Accession MIMAT0018220
Previous IDshvu-miR171
Sequence

112 - 

ugauugagccgugccaauauc

 - 132

Get sequence
Evidence experimental; Illumina [3], Northern [5]

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).
2
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
3
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).
4
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).
5
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).