Stem-loop sequence tae-MIR395a

AccessionMI0016463 (change log)
DescriptionTriticum aestivum miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

12 open access papers mention tae-MIR395a
(29 sentences)

Stem-loop
   cuua   u         g            - a      au 
5'     cag ggguuccuu caagcacuucau g ggcauu  u
       ||| ||||||||| |||||||||||| | ||||||   
3'     guu cucaagggg guuugugaagug c ccguaa  a
   ----   -         -            u a      aa 
Get sequence
Deep sequencing
18590 reads, 13.8 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR395a

Accession MIMAT0018222
Sequence

54 - 

gugaaguguuugggggaacuc

 - 74

Get sequence
Deep sequencing13743 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).