Stem-loop sequence gma-MIR4412

AccessionMI0016578 (change log)
DescriptionGlycine max miR4412 stem-loop
Literature search

3 open access papers mention gma-MIR4412
(6 sentences)

Stem-loop 
           c   u    u    u      g  --   ug  ccu 
5' aacuguug ggg aucu ugcc cugaag aa  agu  ug   a
   |||||||| ||| |||| |||| |||||| ||  |||  ||    
3' uugacaac ccc uaga gcgg gauuuc uu  ucg  au   u
           a   c    u    u      g  au   gu  uau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 37037465-37037552 [-]
intergenic
Database links

Mature sequence gma-miR4412-5p

Accession MIMAT0020954
Sequence

4 -  

uguugcggguaucuuugccuc

 - 24

Get sequence
Evidence experimental; Illumina [3-4]

Mature sequence gma-miR4412-3p

Accession MIMAT0018337
Previous IDsgma-miR4412
Sequence

64 -  

aguggcguagauccccacaac

 - 84

Get sequence
Evidence experimental; Illumina [1], 454 [2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).