![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR4412 |
|||||
Accession | MI0016578 (change log) | ||||
Description | Glycine max miR4412 stem-loop | ||||
Literature search |
3 open access papers mention gma-MIR4412 | ||||
Stem-loop |
c u u u g -- ug ccu 5' aacuguug ggg aucu ugcc cugaag aa agu ug a |||||||| ||| |||| |||| |||||| || ||| || 3' uugacaac ccc uaga gcgg gauuuc uu ucg au u a c u u g au gu uau |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR4412-5p |
|
Accession | MIMAT0020954 |
Sequence |
4 - uguugcggguaucuuugccuc - 24 |
Evidence | experimental; Illumina [3-4] |
Mature sequence gma-miR4412-3p |
|
Accession | MIMAT0018337 |
Previous IDs | gma-miR4412 |
Sequence |
64 - aguggcguagauccccacaac - 84 |
Evidence | experimental; Illumina [1], 454 [2] |
References |
|
1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
2 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
4 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|