Stem-loop sequence hvu-MIR1436

AccessionMI0016743 (change log)
DescriptionHordeum vulgare miR1436 stem-loop
Literature search

1 open access papers mention hvu-MIR1436
(2 sentences)

Stem-loop
   ggcuucccuguauacagacagaguca          -----           cg     
5'                           uacucccucc     auaauguagua  guuu 
                             ||||||||||     |||||||||||  ||| u
3'                           augagggagg     uauuacaucau  cagu 
   ---------------------guuac          caggg           ca     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR1436

Accession MIMAT0018501
Sequence

65 - 

acauuaugggacggagggagu

 - 85

Get sequence
Evidence not experimental

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).