Dead miRNA entry

miRNA accession:
MIR1126 and MIR1132 are related to the MIR8080/809/819 family. The pattern of reads that map to the MIR808/809/819 loci from deep sequencing experiments is more consistent with rasiRNA rather than miRNA processing. The miRNA annotation is therefore likely to be incorrect (Chen et al., RNA Biol. 8:538-547).

Previous miRNA entry

Stem-loop sequence hvu-MIR1126

AccessionMI0016744 (change log)
DescriptionHordeum vulgare miR1126 stem-loop
   uuuuuaa     caa      a       c   acaaaaugagugaacuuacac 
5'        agauu   cuaugg cuacaua gga                     u
          |||||   |||||| ||||||| |||                      
3'        ucuaa   gauacc gauguau ccu                     c
   ------c     agg      c       a   auauauauaucuguauuaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR1126

Accession MIMAT0018502

12 - 


 - 34

Get sequence
Evidence experimental;


PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).