![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence oar-mir-323a |
||||||||||||||||||||||||||||||||
Accession | MI0016923 (change log) | |||||||||||||||||||||||||||||||
Description | Ovis aries miR-323a stem-loop | |||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||
Stem-loop |
----cugcugcuu u g g u gcgc u uua 5' gguacu g agagaggu g ccgug gu cgcu u |||||| | |||||||| | ||||| || |||| 3' cuaugg c uuucucca c ggcac ca gcgg u guuccgcccuaau - g g u auua c uau |
|||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||
Database links |
|
Mature sequence oar-miR-323a-5p |
|
Accession | MIMAT0019259 |
Sequence |
23 - aggugguccguggcgcguucg - 43 |
Deep sequencing | 30 reads, 8 experiments |
Evidence | experimental; Illumina [1], cloned [2] |
Mature sequence oar-miR-323a-3p |
|
Accession | MIMAT0019260 |
Sequence |
58 - cacauuacacggucgaccucu - 78 |
Deep sequencing | 3218 reads, 13 experiments |
Evidence | experimental; Illumina [1], cloned [2] |
References |
|
1 |
PMID:20944086
"Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing"
Genome Res. 20:1651-1662(2010).
|
2 |
PMID:23269700
"MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200"
Physiol Genomics. 45:151-161(2013).
|