![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-3473b |
|||||
Accession | MI0016997 (change log) | ||||
Symbol | MGI:Mir3473b | ||||
Description | Mus musculus miR-3473b stem-loop | ||||
Gene family | MIPF0001230; mir-3473 | ||||
Literature search |
![]()
9 open access papers mention mmu-mir-3473b | ||||
Stem-loop |
--
5' cugagccaucucuccagccc aagauu
|||||||||||||||||||| ||||| a
3' gacucgguagagaggucggg uuuugg
aa
|
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-3473b |
|
Accession | MIMAT0020367 |
Sequence |
36 - gggcuggagagauggcucag - 55 |
Deep sequencing | 55696 reads, 103 experiments |
Evidence | experimental; cloned [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20933514
"The small RNA expression profile of the developing murine urinary and reproductive systems"
FEBS Lett. 584:4426-4434(2010).
|