miRBase entry: hsa-mir-4647

Stem-loop hsa-mir-4647


Accession
MI0017274
Symbol
HGNC: MIR4647
Description
Homo sapiens hsa-mir-4647 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4647 is a non-coding RNA that is located within the 3'-UTR of the SLC35B2 gene [PMC9296583]. It is one of the eight upregulated miRNA sequences found in non-protein coding genes [PMC5823624]. The effects of MIR4647 on cell migration and colony forming were analyzed by optimizing the transfection process of corresponding miRNA precursors [PMC9843305]. The perturbation of MIR4647 by a miRNA inhibitor did not suppress the cytopathic effects of HSV-1 infection [PMC9296583'>PMC9296583]. The genomic locus of MIR4647 overlaps with the 3'-UTR of SLC35B2, suggesting that sgRNAs targeting MIR4647 may reduce the expression of SLC35B2 [PMC9296583]. In a screen, MIR4647 was identified as a candidate miRNA, along with three candidate genes (IRF2BPL, PAPSS1, and VANGL2) [PMC9296583]. Overall, MIR4647 is an intragenic miRNA residing within an upregulated gene and its role in cell migration and colony forming has been investigated [PMC5823624'>PMC5823624] [PMC9843305'>PMC9843305] [PMC9296583].

References:
- PMC5823624
- PMC9843305
- PMC5069896
- PMC9296583

Literature search
1 open access papers mention hsa-mir-4647
(1 sentences)

Sequence

429 reads, 30 reads per million, 38 experiments
ccaggaggguGAAGAUGGUGCUGUGCUGAGGAAaggggaugcagagcccugcccagcaccaccaccuccuaugcuccugg
(((((((.(((.((.(((((..((((((.((..((((.........)))).))))))))))))).))..))).)))))))

Structure
       g   -A  A     CU      A  AA    gau 
ccaggag guG  AG UGGUG  GUGCUG GG  aggg   g
||||||| |||  || |||||  |||||| ||  ||||   c
gguccuc uau  uc accac  cacgac cc  uccc   a
       g   cc  c     --      -  -g    gag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr6: 44254206-44254285 [-]

Disease association
hsa-mir-4647 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4647

Accession MIMAT0019709
Description Homo sapiens hsa-miR-4647 mature miRNA
Sequence 11 - GAAGAUGGUGCUGUGCUGAGGAA - 33
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86