Stem-loop sequence hsa-mir-1343

Accession

MI0017320 (change log)

Symbol

HGNC:MIR1343

Description

Homo sapiens miR-1343 stem-loop

Gene family

MIPF0001206; mir-1343

Literature search

2 open access papers mention hsa-mir-1343
(2 sentences)

Stem-loop

     u   g    u  u    a    c       -u     ucu 
5' gc ggc ucgg gc gggg gcgg ccccggg  gggcc   g
   || ||| |||| || |||| |||| |||||||  |||||    
3' cg ccg gguc cg ucuc cgcc ggggucc  cccgg   c
     c   -    u  c    a    c       uc     ucu 

Deep sequencing

523 reads, 0 reads per million, 108 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 34941837-34941920 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000390015 ; PDHX-003; intron 1

  OTTHUMT00000390016 ; PDHX-002; intron 1

  OTTHUMT00000390017 ; PDHX-001; intron 1

  OTTHUMT00000390018 ; PDHX-004; intron 1

  OTTHUMT00000390019 ; PDHX-008; intron 1

  ENST00000533550 ; PDHX-003; intron 1

  ENST00000448838 ; PDHX-002; intron 1

  ENST00000227868 ; PDHX-001; intron 1

  ENST00000430469 ; PDHX-004; intron 1

  ENST00000533262 ; PDHX-008; intron 1

Database links

• EntrezGene:MIR1343
• HGNC:MIR1343
• miRBase Tracker:MI0017320

Mature sequence hsa-miR-1343-5p

• Accession: MIMAT0027038
• Sequence: 15 - uggggagcggcccccggguggg - 36
• Deep sequencing: 107 reads, 38 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:hsa-miR-1343-5p
  • miRDB:hsa-miR-1343-5p

Mature sequence hsa-miR-1343-3p

• Accession: MIMAT0019776
• Sequence: 52 - cuccuggggcccgcacucucgc - 73
• Deep sequencing: 390 reads, 99 experiments
• Evidence: experimental; Illumina [1-2]
• Predicted targets:
  • TargetScanVert:hsa-miR-1343-3p
  • miRDB:hsa-miR-1343-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).