![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4740 |
|||||
Accession | MI0017378 (change log) | ||||
Symbol | HGNC:MIR4740 | ||||
Description | Homo sapiens miR-4740 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4740 | ||||
Stem-loop |
gc a u a gag a 5' ca ggac gauccucucgggc gg uc g || |||| ||||||||||||| || || a 3' gu ccug cuaggagagcccg cc gg g -c c c - --a g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4740-5p |
|
Accession | MIMAT0019869 |
Sequence |
5 - aggacugauccucucgggcagg - 26 |
Deep sequencing | 31 reads, 22 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4740-3p |
|
Accession | MIMAT0019870 |
Sequence |
42 - gcccgagaggauccgucccugc - 63 |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|