Stem-loop sequence egr-mir-1

AccessionMI0017775 (change log)
DescriptionEchinococcus granulosus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention egr-mir-1
(5 sentences)

Stem-loop 
   ----     c     gg       guaag      ca 
5'     gcuuc caaua  ccauaga     ucccua  c
       ||||| |||||  |||||||     ||||||   
3'     ugaag guugu  gguaucu     aggggu  c
   ugua     u     aa       -----      au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000107.1: 117513-117579 [+]
intergenic
Database links

Mature sequence egr-miR-1-5p

Accession MIMAT0020228
Sequence

48 -  

uggaauguugugaaguaugu

 - 67

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25656283 "microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach" Macchiaroli N, Cucher M, Zarowiecki M, Maldonado L, Kamenetzky L, Rosenzvit MC Parasit Vectors. 8:83(2015).