![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-2c |
||||||||||
Accession | MI0017778 (change log) | |||||||||
Description | Echinococcus granulosus miR-2c stem-loop | |||||||||
Gene family | MIPF0000049; mir-2 | |||||||||
Literature search |
1 open access papers mention egr-mir-2c | |||||||||
Stem-loop |
ug - c c a - g 5' gggcgu uucgu cgucaa auug cugu gaca cg g |||||| ||||| |||||| |||| |||| |||| || u 3' ucugcg gagca guaguu uaac gaca cugu gc u gu a a c - a g |
|||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence egr-miR-2c-5p |
|
Accession | MIMAT0020231 |
Previous IDs | egr-miR-2c* |
Sequence |
13 - ucgucaacauugccuguagaca - 34 |
Evidence | experimental; cloned [1], Illumina [2] |
Mature sequence egr-miR-2c-3p |
|
Accession | MIMAT0020232 |
Previous IDs | egr-miR-2c |
Sequence |
47 - ucacagccaauauugaugaa - 66 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|