![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-7 |
|||||
Accession | MI0017779 (change log) | ||||
Description | Echinococcus granulosus miR-7 stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
2 open access papers mention egr-mir-7 | ||||
Stem-loop |
cau c u - g aa cuc 5' ug uuuug ggaaga cug ugauauguugua g c || ||||| |||||| ||| |||||||||||| | 3' ac aaaau ccuuuu gac gcuaugcgacau c c -uu a c u - ac auc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence egr-miR-7-5p |
|
Accession | MIMAT0020233 |
Sequence |
12 - uggaagacuggugauauguugu - 33 |
Evidence | experimental; cloned [1], Illumina [2] |
Mature sequence egr-miR-7-3p |
|
Accession | MIMAT0037421 |
Sequence |
51 - cagcguaucgcaguuuuucccu - 72 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|