![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-8 |
|||||
Accession | MI0017780 (change log) | ||||
Description | Echinococcus granulosus miR-8 stem-loop | ||||
Gene family | MIPF0000019; mir-8 | ||||
Stem-loop |
cg g a -- guggacguuuuaaucggu 5' ag cauuguggu gucuu ccgagcaguau c || ||||||||| ||||| ||||||||||| c 3' uc gugacaccg cagga ggcuugucaua a -- g - uu auccucgacaaccccgcc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence egr-miR-8-5p |
|
Accession | MIMAT0037422 |
Sequence |
13 - guagucuuccgagcaguaugu - 33 |
Evidence | experimental; Illumina [2] |
Mature sequence egr-miR-8-3p |
|
Accession | MIMAT0020234 |
Sequence |
69 - uaauacuguucgguuaggacgcc - 91 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|