![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-9 |
|||||
Accession | MI0017781 (change log) | ||||
Description | Echinococcus granulosus miR-9 stem-loop | ||||
Gene family | MIPF0000014; mir-9 | ||||
Literature search |
1 open access papers mention egr-mir-9 | ||||
Stem-loop |
- u cauuc uu g --uuu uc 5' uag ugc uuugg aucuagcu ugugagg agcu a ||| ||| ||||| |||||||| ||||||| |||| 3' auc acg aaacc uagaucgg acacuuu ucga g a c caaac uu a uauuc cu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence egr-miR-9-5p |
|
Accession | MIMAT0020235 |
Sequence |
11 - ucuuugguuaucuagcugugug - 32 |
Evidence | experimental; cloned [1], Illumina [2] |
Mature sequence egr-miR-9-3p |
|
Accession | MIMAT0037423 |
Sequence |
63 - caaggcuagauuuccaaacaaa - 84 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|