![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-10a |
|||||
Accession | MI0017782 (change log) | ||||
Description | Echinococcus granulosus miR-10a stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
1 open access papers mention egr-mir-10a | ||||
Stem-loop |
--cac -gu c -- g uagc uu 5' ccu agac cgaguuu gagu cc guacg c ||| |||| ||||||| |||| || ||||| 3' gga ucug gcucgaa cuca gg caugc c acuac acu u cc - ---- ca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence egr-miR-10a-5p |
|
Accession | MIMAT0020236 |
Sequence |
1 - cacccuguagacccgaguuuga - 22 |
Evidence | experimental; cloned [1], Illumina [2] |
Mature sequence egr-miR-10a-3p |
|
Accession | MIMAT0037424 |
Sequence |
58 - gcucgugucuucaaggcauc - 77 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|