![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-125 |
|||||
Accession | MI0017787 (change log) | ||||
Description | Echinococcus granulosus miR-125 stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
2 open access papers mention egr-mir-125 | ||||
Stem-loop |
-- u u a cc - - -uuu c a 5' caug ccc g gac uagaguuguc cg ga ug g a |||| ||| | ||| |||||||||| || || || | 3' guau ggg c cug aucucaacgg gc cu ac c u ga u c - ua u a cuuu a c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence egr-miR-125-5p |
|
Accession | MIMAT0020243 |
Sequence |
5 - ucccugagacccuagaguuguc - 26 |
Evidence | experimental; cloned [1], Illumina [2] |
Mature sequence egr-miR-125-3p |
|
Accession | MIMAT0037427 |
Sequence |
58 - caacucuaaugucccggguuau - 79 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|