![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence egr-mir-277a |
||||||
Accession | MI0017791 (change log) | |||||
Description | Echinococcus granulosus miR-277a stem-loop | |||||
Gene family | MIPF0001221; mir-277_2 | |||||
Literature search |
![]()
2 open access papers mention egr-mir-277a | |||||
Stem-loop |
------ - cu - -c cc u 5' gggu agaaagugc uuuacaa caug ug uc a |||| ||||||||| ||||||| |||| || || u 3' cccg ucuuuuacg aaauguu guau ac ag g ccaaug g -u u uc cu a |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence egr-miR-277a-3p |
|
Accession | MIMAT0020247 |
Sequence |
55 - uaaaugcauuuucuggcccgua - 76 |
Evidence | experimental; cloned [1], Illumina [2] |
References |
|
1 |
PMID:21219906
"Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes"
Int J Parasitol. 41:439-448(2011).
|
2 |
PMID:25656283
"microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach"
Parasit Vectors. 8:83(2015).
|